ID: 940610191

View in Genome Browser
Species Human (GRCh38)
Location 2:155980372-155980394
Sequence CAGAAGATTCCTGTATAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940610191_940610197 6 Left 940610191 2:155980372-155980394 CCCACCTATACAGGAATCTTCTG No data
Right 940610197 2:155980401-155980423 ACACATCCATCTTGGCCACCAGG No data
940610191_940610196 -2 Left 940610191 2:155980372-155980394 CCCACCTATACAGGAATCTTCTG No data
Right 940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940610191 Original CRISPR CAGAAGATTCCTGTATAGGT GGG (reversed) Intergenic
No off target data available for this crispr