ID: 940610192

View in Genome Browser
Species Human (GRCh38)
Location 2:155980373-155980395
Sequence CCAGAAGATTCCTGTATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940610192_940610197 5 Left 940610192 2:155980373-155980395 CCACCTATACAGGAATCTTCTGG No data
Right 940610197 2:155980401-155980423 ACACATCCATCTTGGCCACCAGG No data
940610192_940610196 -3 Left 940610192 2:155980373-155980395 CCACCTATACAGGAATCTTCTGG No data
Right 940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940610192 Original CRISPR CCAGAAGATTCCTGTATAGG TGG (reversed) Intergenic
No off target data available for this crispr