ID: 940610194

View in Genome Browser
Species Human (GRCh38)
Location 2:155980374-155980396
Sequence CACCTATACAGGAATCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940610189_940610194 2 Left 940610189 2:155980349-155980371 CCTTGCAGCAGTCATGGCATTGT No data
Right 940610194 2:155980374-155980396 CACCTATACAGGAATCTTCTGGG No data
940610185_940610194 21 Left 940610185 2:155980330-155980352 CCAGAGTCAGTTCCAGCACCCTT No data
Right 940610194 2:155980374-155980396 CACCTATACAGGAATCTTCTGGG No data
940610186_940610194 9 Left 940610186 2:155980342-155980364 CCAGCACCCTTGCAGCAGTCATG No data
Right 940610194 2:155980374-155980396 CACCTATACAGGAATCTTCTGGG No data
940610188_940610194 3 Left 940610188 2:155980348-155980370 CCCTTGCAGCAGTCATGGCATTG No data
Right 940610194 2:155980374-155980396 CACCTATACAGGAATCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940610194 Original CRISPR CACCTATACAGGAATCTTCT GGG Intergenic
No off target data available for this crispr