ID: 940610196

View in Genome Browser
Species Human (GRCh38)
Location 2:155980393-155980415
Sequence TGGGAGACACACATCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940610189_940610196 21 Left 940610189 2:155980349-155980371 CCTTGCAGCAGTCATGGCATTGT No data
Right 940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG No data
940610186_940610196 28 Left 940610186 2:155980342-155980364 CCAGCACCCTTGCAGCAGTCATG No data
Right 940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG No data
940610191_940610196 -2 Left 940610191 2:155980372-155980394 CCCACCTATACAGGAATCTTCTG No data
Right 940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG No data
940610195_940610196 -6 Left 940610195 2:155980376-155980398 CCTATACAGGAATCTTCTGGGAG No data
Right 940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG No data
940610192_940610196 -3 Left 940610192 2:155980373-155980395 CCACCTATACAGGAATCTTCTGG No data
Right 940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG No data
940610188_940610196 22 Left 940610188 2:155980348-155980370 CCCTTGCAGCAGTCATGGCATTG No data
Right 940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940610196 Original CRISPR TGGGAGACACACATCCATCT TGG Intergenic
No off target data available for this crispr