ID: 940612422

View in Genome Browser
Species Human (GRCh38)
Location 2:156007273-156007295
Sequence TAGAAACCCAGAGCCCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940612414_940612422 18 Left 940612414 2:156007232-156007254 CCAGCCATGAGTGACCACGTGCA No data
Right 940612422 2:156007273-156007295 TAGAAACCCAGAGCCCTCGTGGG No data
940612416_940612422 4 Left 940612416 2:156007246-156007268 CCACGTGCAGAGCCACCTCCAGA No data
Right 940612422 2:156007273-156007295 TAGAAACCCAGAGCCCTCGTGGG No data
940612418_940612422 -8 Left 940612418 2:156007258-156007280 CCACCTCCAGAGGCATAGAAACC No data
Right 940612422 2:156007273-156007295 TAGAAACCCAGAGCCCTCGTGGG No data
940612415_940612422 14 Left 940612415 2:156007236-156007258 CCATGAGTGACCACGTGCAGAGC No data
Right 940612422 2:156007273-156007295 TAGAAACCCAGAGCCCTCGTGGG No data
940612413_940612422 19 Left 940612413 2:156007231-156007253 CCCAGCCATGAGTGACCACGTGC No data
Right 940612422 2:156007273-156007295 TAGAAACCCAGAGCCCTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940612422 Original CRISPR TAGAAACCCAGAGCCCTCGT GGG Intergenic
No off target data available for this crispr