ID: 940614861

View in Genome Browser
Species Human (GRCh38)
Location 2:156037755-156037777
Sequence CCTATGTGTAAGTACAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940614861_940614866 29 Left 940614861 2:156037755-156037777 CCTGGTTTGTACTTACACATAGG No data
Right 940614866 2:156037807-156037829 TTCATGCCAGTTTTTGAGGCAGG No data
940614861_940614865 25 Left 940614861 2:156037755-156037777 CCTGGTTTGTACTTACACATAGG No data
Right 940614865 2:156037803-156037825 TCATTTCATGCCAGTTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940614861 Original CRISPR CCTATGTGTAAGTACAAACC AGG (reversed) Intergenic
No off target data available for this crispr