ID: 940616583

View in Genome Browser
Species Human (GRCh38)
Location 2:156056111-156056133
Sequence CTCCTTCTTTCTTGGAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940616583_940616586 15 Left 940616583 2:156056111-156056133 CCTGTATTCCAAGAAAGAAGGAG No data
Right 940616586 2:156056149-156056171 CTTAAGACAGCCTAGAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940616583 Original CRISPR CTCCTTCTTTCTTGGAATAC AGG (reversed) Intergenic
No off target data available for this crispr