ID: 940619355

View in Genome Browser
Species Human (GRCh38)
Location 2:156091588-156091610
Sequence ATGATTACAAAGATGAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940619355_940619357 19 Left 940619355 2:156091588-156091610 CCATGATTCATCTTTGTAATCAT No data
Right 940619357 2:156091630-156091652 TTCTTTTCATAATATTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940619355 Original CRISPR ATGATTACAAAGATGAATCA TGG (reversed) Intergenic
No off target data available for this crispr