ID: 940621641

View in Genome Browser
Species Human (GRCh38)
Location 2:156120962-156120984
Sequence AAGCCATTAAACAAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5871
Summary {0: 18, 1: 1557, 2: 1958, 3: 1378, 4: 960}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940621641_940621646 24 Left 940621641 2:156120962-156120984 CCTAGAGACTTGTTTAATGGCTT 0: 18
1: 1557
2: 1958
3: 1378
4: 960
Right 940621646 2:156121009-156121031 GGGCAATGAAGTCCAGGCTCAGG No data
940621641_940621643 3 Left 940621641 2:156120962-156120984 CCTAGAGACTTGTTTAATGGCTT 0: 18
1: 1557
2: 1958
3: 1378
4: 960
Right 940621643 2:156120988-156121010 CCAAAATGCTAATAGTGATATGG 0: 65
1: 1134
2: 1757
3: 1525
4: 1303
940621641_940621645 18 Left 940621641 2:156120962-156120984 CCTAGAGACTTGTTTAATGGCTT 0: 18
1: 1557
2: 1958
3: 1378
4: 960
Right 940621645 2:156121003-156121025 TGATATGGGCAATGAAGTCCAGG 0: 17
1: 555
2: 1444
3: 1685
4: 1758
940621641_940621647 27 Left 940621641 2:156120962-156120984 CCTAGAGACTTGTTTAATGGCTT 0: 18
1: 1557
2: 1958
3: 1378
4: 960
Right 940621647 2:156121012-156121034 CAATGAAGTCCAGGCTCAGGTGG No data
940621641_940621644 4 Left 940621641 2:156120962-156120984 CCTAGAGACTTGTTTAATGGCTT 0: 18
1: 1557
2: 1958
3: 1378
4: 960
Right 940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940621641 Original CRISPR AAGCCATTAAACAAGTCTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr