ID: 940621644

View in Genome Browser
Species Human (GRCh38)
Location 2:156120989-156121011
Sequence CAAAATGCTAATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940621641_940621644 4 Left 940621641 2:156120962-156120984 CCTAGAGACTTGTTTAATGGCTT 0: 18
1: 1557
2: 1958
3: 1378
4: 960
Right 940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940621644 Original CRISPR CAAAATGCTAATAGTGATAT GGG Intergenic
No off target data available for this crispr