ID: 940624737

View in Genome Browser
Species Human (GRCh38)
Location 2:156159603-156159625
Sequence ATCTGGGAAGGGCAATTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940624731_940624737 -3 Left 940624731 2:156159583-156159605 CCTTCGTTGCTTCATGCGAGATC No data
Right 940624737 2:156159603-156159625 ATCTGGGAAGGGCAATTTCAGGG No data
940624730_940624737 -2 Left 940624730 2:156159582-156159604 CCCTTCGTTGCTTCATGCGAGAT No data
Right 940624737 2:156159603-156159625 ATCTGGGAAGGGCAATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940624737 Original CRISPR ATCTGGGAAGGGCAATTTCA GGG Intergenic