ID: 940635412

View in Genome Browser
Species Human (GRCh38)
Location 2:156292780-156292802
Sequence AGGGCTGATGCAGCTTGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940635402_940635412 21 Left 940635402 2:156292736-156292758 CCAGATCCCAGTTAGAGTCACAG No data
Right 940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG No data
940635405_940635412 14 Left 940635405 2:156292743-156292765 CCAGTTAGAGTCACAGTATGGAG No data
Right 940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG No data
940635404_940635412 15 Left 940635404 2:156292742-156292764 CCCAGTTAGAGTCACAGTATGGA No data
Right 940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940635412 Original CRISPR AGGGCTGATGCAGCTTGTAT AGG Intergenic
No off target data available for this crispr