ID: 940640852

View in Genome Browser
Species Human (GRCh38)
Location 2:156342709-156342731
Sequence CCGCGAACCGCGCTCCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 82}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940640852_940640859 1 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 940640859 2:156342733-156342755 TGGGAAGGAGCCCGGCGTGCTGG 0: 1
1: 1
2: 1
3: 28
4: 364
940640852_940640862 20 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 940640862 2:156342752-156342774 CTGGCGTCCCCGAGTGCTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 160
940640852_940640858 -7 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 940640858 2:156342725-156342747 TTCGCGGGTGGGAAGGAGCCCGG 0: 1
1: 0
2: 1
3: 13
4: 181
940640852_940640870 30 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 940640870 2:156342762-156342784 CGAGTGCTGCCGGGGCCCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 145
940640852_940640864 22 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 940640864 2:156342754-156342776 GGCGTCCCCGAGTGCTGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 96
940640852_940640867 28 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 940640867 2:156342760-156342782 CCCGAGTGCTGCCGGGGCCCCGG 0: 1
1: 0
2: 4
3: 23
4: 269
940640852_940640863 21 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 940640863 2:156342753-156342775 TGGCGTCCCCGAGTGCTGCCGGG 0: 1
1: 0
2: 2
3: 6
4: 169
940640852_940640869 29 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 940640869 2:156342761-156342783 CCGAGTGCTGCCGGGGCCCCGGG 0: 1
1: 0
2: 1
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940640852 Original CRISPR CCGCGAACCGCGCTCCCCGC AGG (reversed) Intergenic
901489441 1:9589130-9589152 CCGGGACCCGGGCTGCCCGCGGG + Intronic
903175487 1:21577789-21577811 CCGCCCACCTCGCTCCCCTCTGG + Exonic
904050203 1:27634273-27634295 TCTCGGCCCGCGCTCCCCGCTGG - Intronic
917937463 1:179882661-179882683 CCGAGAACCTCACTTCCCGCCGG - Exonic
921152637 1:212414392-212414414 CAGCCTTCCGCGCTCCCCGCCGG - Intronic
1062774859 10:135968-135990 CCCGGAGCCGCGTTCCCCGCCGG - Intronic
1074121679 10:110498075-110498097 CCCCGCGCCGCGCGCCCCGCGGG - Exonic
1076998638 11:311264-311286 CCGCGTCCCGCCCACCCCGCGGG - Intronic
1077000105 11:318495-318517 CCGCGTCCCGCCCACCCCGCGGG + Intergenic
1080779717 11:35419203-35419225 CCGCCAAGCGCCATCCCCGCGGG - Exonic
1086361937 11:86068901-86068923 CCCCGAACCGCGCCCCAGGCCGG - Exonic
1089432366 11:118435373-118435395 CCGCGCACAGAGCTCGCCGCCGG + Intergenic
1091281421 11:134383805-134383827 CCGCGACCCACGCATCCCGCGGG - Exonic
1095271570 12:40225001-40225023 CCGCAGCCAGCGCTCCCCGCGGG - Intronic
1097088817 12:56488784-56488806 CCGCGCGCCACGCTACCCGCCGG - Intergenic
1103822815 12:123712297-123712319 CCGCGTCCCGCCCCCCCCGCCGG - Exonic
1105935632 13:25095984-25096006 CCGCTACCCTGGCTCCCCGCCGG + Exonic
1118887593 14:69879635-69879657 CCGCGAACCCCGCTCGCTGCCGG + Exonic
1122162239 14:99793164-99793186 GCCCGGGCCGCGCTCCCCGCGGG + Intronic
1122545057 14:102517354-102517376 CCGCGGACCGCGCTGGGCGCAGG + Intergenic
1125516365 15:40323524-40323546 CCGGGAGCCGCGAGCCCCGCCGG - Intergenic
1127221706 15:56887294-56887316 CCGCGAACCTCTCGCCCCGCCGG + Intronic
1127770190 15:62224467-62224489 CCGCGAACAGCGTGCCTCGCTGG - Intergenic
1132754300 16:1475139-1475161 CTGGGAGCCGCGCTCCCGGCGGG + Exonic
1132869424 16:2109164-2109186 CCGAGAGCCGCGCTGCACGCGGG + Exonic
1132987726 16:2776822-2776844 GCGCGAGCTGCGCTCGCCGCGGG - Intronic
1134717988 16:16366435-16366457 CCGAGAGCCGCGCTGCACGCGGG - Intergenic
1134956763 16:18385724-18385746 CCGAGAGCCGCGCTGCACGCGGG + Intergenic
1136637996 16:31537778-31537800 CAGCGCGCCGCGATCCCCGCTGG - Intergenic
1142395427 16:89828816-89828838 CCCCAGACCGCGGTCCCCGCCGG - Intronic
1142708470 17:1710484-1710506 CCCCGAACCGCTCCCCCGGCTGG - Intergenic
1147429539 17:40363026-40363048 CCCCGAGCCGTGCGCCCCGCCGG - Exonic
1153457280 18:5295425-5295447 CGGCGGGCCGCGCTCCGCGCTGG + Intronic
1154304041 18:13217954-13217976 CGGCGCGCCGCGCTCCCCGCCGG + Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1162911001 19:13847712-13847734 CCCCTAACCCCGCTCCCGGCCGG + Intergenic
1167142455 19:47661423-47661445 CCGCGAACCCCCTTCCTCGCTGG - Intronic
925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG + Intergenic
932496300 2:72147449-72147471 CCCGGAACCGCGCTGCCGGCGGG + Intronic
933911256 2:86942839-86942861 CCGCCCACCGCGGTCCCCCCAGG - Intronic
934966737 2:98730742-98730764 CCCCGCACCGCGCACCCCTCGGG - Intronic
935301473 2:101697409-101697431 CCGCTGCCCGCGCTGCCCGCCGG + Intronic
939630841 2:144524439-144524461 CCGCGAGCCGCGCTCCGAGCGGG + Intronic
940640852 2:156342709-156342731 CCGCGAACCGCGCTCCCCGCAGG - Intergenic
943589954 2:189784691-189784713 CAGCTAAGGGCGCTCCCCGCGGG + Intronic
948140491 2:235669541-235669563 CCGCGGGCCGCGCGCCCAGCCGG - Intronic
1172661796 20:36573671-36573693 CGGCGCCCCCCGCTCCCCGCCGG + Intronic
1175367841 20:58467705-58467727 CCGCGAGCCCCTCTCCCCTCTGG + Intronic
1175958012 20:62621283-62621305 CTGCGCACCCCGATCCCCGCCGG + Intergenic
1176548899 21:8213229-8213251 CCCCGACCCTCTCTCCCCGCCGG - Intergenic
1176556794 21:8257442-8257464 CCCCGACCCTCTCTCCCCGCCGG - Intergenic
1176567830 21:8396264-8396286 CCCCGACCCTCTCTCCCCGCCGG - Intergenic
1176575733 21:8440483-8440505 CCCCGACCCTCTCTCCCCGCCGG - Intergenic
1182222944 22:28773009-28773031 CCGCGCGCCGCACTCCCAGCGGG - Exonic
1203253784 22_KI270733v1_random:129537-129559 CCCCGACCCTCTCTCCCCGCCGG - Intergenic
1203261840 22_KI270733v1_random:174616-174638 CCCCGACCCTCTCTCCCCGCCGG - Intergenic
950282652 3:11720356-11720378 GCCCGAGCCGCGCTCCCCGACGG + Intronic
950316243 3:12004354-12004376 CCGCGAGCCTCGCGCCGCGCGGG + Intergenic
951558651 3:23945358-23945380 CGGCGAGCGGCGCTCCTCGCTGG - Exonic
955916447 3:63912495-63912517 CCGCGGGCCGCGCACGCCGCCGG + Intronic
958638542 3:96776880-96776902 CCGCGGGCCGCGCCCGCCGCCGG + Intergenic
962222299 3:133573990-133574012 CCGCGGGCCGCGCCCGCCGCCGG + Exonic
964801627 3:160565005-160565027 CCGGGCACCTCGCTCCCCGGCGG + Intronic
966696335 3:182793714-182793736 CCGCGGCCCCCGCGCCCCGCGGG + Exonic
967858177 3:194134080-194134102 CCGCGAGCCGAGCTCCCAGGCGG + Intergenic
968698206 4:2042714-2042736 CCCTGACCCGCGCCCCCCGCAGG + Exonic
969436676 4:7192860-7192882 CCGGGCTCCGCGCGCCCCGCGGG - Exonic
980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG + Intronic
983484619 4:168318653-168318675 CCGCGAGCTGCGCGCCCCGCGGG + Exonic
998130339 5:139648561-139648583 CCGCGAGCCGCGCTCAGCTCGGG + Exonic
998130737 5:139649937-139649959 GCGCACCCCGCGCTCCCCGCCGG - Intronic
1003098137 6:3157748-3157770 CCGGGCACCGCACTCACCGCCGG - Intergenic
1005332224 6:24761339-24761361 CCCCGAACCACGCTCCCCTTGGG - Intergenic
1022943056 7:35257778-35257800 CCGCGCCGCGCGCTCCCCACGGG - Intergenic
1027025809 7:74851195-74851217 CCCCGAACCCCGATCCCTGCTGG - Intronic
1027061952 7:75092924-75092946 CCCCGAACCCCGATCCCTGCTGG + Intronic
1029441037 7:100586715-100586737 CGGCGAACTGCGTTCCCGGCCGG - Intronic
1035008147 7:155685583-155685605 CCACGAACCTCTCTCCCCACGGG - Intronic
1038450026 8:27633917-27633939 CCGCCGCCCGCGCTTCCCGCTGG - Intronic
1040495399 8:47961026-47961048 CCGCGCCACGCCCTCCCCGCCGG - Exonic
1044306408 8:90645759-90645781 CGGCGGACCGCCTTCCCCGCGGG - Exonic
1045277613 8:100721777-100721799 CCGCCACCCTCGCTCCCCGCCGG - Exonic
1047732404 8:127737792-127737814 GCGTGAACCCCGCTCCGCGCCGG - Intronic
1049471604 8:142777344-142777366 CCCCGAGCCGAGCTCACCGCAGG + Intronic
1049716415 8:144095141-144095163 CCGGGAGCCCCGCGCCCCGCGGG - Exonic
1057337241 9:94165921-94165943 CCGCTGAACGCGCTGCCCGCGGG - Intergenic
1060971836 9:127742787-127742809 CCGGCTACCGCACTCCCCGCTGG - Intronic
1061450972 9:130666832-130666854 CCGCGACCAGCGCCCCTCGCCGG - Intronic
1203470184 Un_GL000220v1:112685-112707 CCCCGACCCTCTCTCCCCGCCGG - Intergenic
1203478005 Un_GL000220v1:156657-156679 CCCCGACCCTCTCTCCCCGCCGG - Intergenic