ID: 940640852

View in Genome Browser
Species Human (GRCh38)
Location 2:156342709-156342731
Sequence CCGCGAACCGCGCTCCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940640852_940640869 29 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG No data
Right 940640869 2:156342761-156342783 CCGAGTGCTGCCGGGGCCCCGGG No data
940640852_940640863 21 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG No data
Right 940640863 2:156342753-156342775 TGGCGTCCCCGAGTGCTGCCGGG No data
940640852_940640867 28 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG No data
Right 940640867 2:156342760-156342782 CCCGAGTGCTGCCGGGGCCCCGG No data
940640852_940640862 20 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG No data
Right 940640862 2:156342752-156342774 CTGGCGTCCCCGAGTGCTGCCGG No data
940640852_940640870 30 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG No data
Right 940640870 2:156342762-156342784 CGAGTGCTGCCGGGGCCCCGGGG No data
940640852_940640859 1 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG No data
Right 940640859 2:156342733-156342755 TGGGAAGGAGCCCGGCGTGCTGG No data
940640852_940640858 -7 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG No data
Right 940640858 2:156342725-156342747 TTCGCGGGTGGGAAGGAGCCCGG No data
940640852_940640864 22 Left 940640852 2:156342709-156342731 CCTGCGGGGAGCGCGGTTCGCGG No data
Right 940640864 2:156342754-156342776 GGCGTCCCCGAGTGCTGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940640852 Original CRISPR CCGCGAACCGCGCTCCCCGC AGG (reversed) Intergenic