ID: 940650379

View in Genome Browser
Species Human (GRCh38)
Location 2:156435729-156435751
Sequence CCCGGCCGGCAGGCTTCCCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940650379_940650386 8 Left 940650379 2:156435729-156435751 CCTAGGGAAGCCTGCCGGCCGGG 0: 1
1: 0
2: 3
3: 7
4: 220
Right 940650386 2:156435760-156435782 AGTAGGAGAAGCCAGATCCCAGG 0: 1
1: 0
2: 1
3: 21
4: 260
940650379_940650387 9 Left 940650379 2:156435729-156435751 CCTAGGGAAGCCTGCCGGCCGGG 0: 1
1: 0
2: 3
3: 7
4: 220
Right 940650387 2:156435761-156435783 GTAGGAGAAGCCAGATCCCAGGG 0: 1
1: 1
2: 2
3: 26
4: 250
940650379_940650384 -9 Left 940650379 2:156435729-156435751 CCTAGGGAAGCCTGCCGGCCGGG 0: 1
1: 0
2: 3
3: 7
4: 220
Right 940650384 2:156435743-156435765 CCGGCCGGGAGGTACAGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 87
940650379_940650388 12 Left 940650379 2:156435729-156435751 CCTAGGGAAGCCTGCCGGCCGGG 0: 1
1: 0
2: 3
3: 7
4: 220
Right 940650388 2:156435764-156435786 GGAGAAGCCAGATCCCAGGGCGG 0: 1
1: 0
2: 9
3: 55
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940650379 Original CRISPR CCCGGCCGGCAGGCTTCCCT AGG (reversed) Exonic
900308028 1:2020275-2020297 CCTGGCTGGCCGCCTTCCCTAGG + Intronic
901232187 1:7647455-7647477 CCGGGGAGTCAGGCTTCCCTGGG - Intronic
901458662 1:9378262-9378284 CTCGGCCTGGGGGCTTCCCTCGG - Intergenic
902873183 1:19326334-19326356 CGCCCCCGGAAGGCTTCCCTAGG - Exonic
905499793 1:38427381-38427403 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
909729441 1:78874587-78874609 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
909776678 1:79491973-79491995 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
909788517 1:79643727-79643749 CTGGGAAGGCAGGCTTCCCTTGG - Intergenic
914490246 1:148146982-148147004 GCCGGGGGGCGGGCTTCCCTGGG + Intronic
915102938 1:153513759-153513781 CCCAGGCGGCAGGCTTCACCGGG + Intergenic
916259057 1:162822530-162822552 CCCGGGAGGCTGGCATCCCTGGG + Intergenic
920022527 1:202966873-202966895 CCCGTCCTGCTGGCCTCCCTGGG - Exonic
920167384 1:204045460-204045482 CTGGCCCGACAGGCTTCCCTTGG + Intergenic
920511506 1:206555705-206555727 CCCAGCCGGCTGGCCGCCCTCGG - Intronic
920901516 1:210114223-210114245 CCCGGGCTGCAGGCATTCCTTGG + Intronic
921390290 1:214608231-214608253 GCCGGGGGGCGGGCTTCCCTGGG - Intronic
921732958 1:218597203-218597225 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
923962511 1:239101953-239101975 CTGGGAAGGCAGGCTTCCCTTGG + Intergenic
1068058335 10:52037176-52037198 CCCGGGCTGCAGGCATTCCTTGG + Intronic
1068230987 10:54169055-54169077 CCCGGGCTGCAGGCATTCCTTGG - Intronic
1068348420 10:55813654-55813676 ACTGGCCTGCAGGCATCCCTTGG + Intergenic
1069874174 10:71551606-71551628 CCCTGCTGGAAGGCTTTCCTAGG - Intronic
1070285996 10:75084130-75084152 CACACCAGGCAGGCTTCCCTGGG + Intergenic
1070850227 10:79557298-79557320 CCCGACCTGCAGGCTCCCCTCGG + Exonic
1070856998 10:79614002-79614024 CCCGACCTGCGGGCTCCCCTCGG - Exonic
1073553776 10:104428232-104428254 CCCTGTGGGCATGCTTCCCTCGG - Intronic
1074028742 10:109663700-109663722 ACTGGCCTGCAGGCTCCCCTCGG + Intergenic
1077186008 11:1235677-1235699 CACAGGCGGCAGGCGTCCCTGGG + Intronic
1077295632 11:1825139-1825161 CCAGGCCGGCAGGCTGGGCTGGG + Intergenic
1081159413 11:39734886-39734908 CCGGGAAGGCAGCCTTCCCTTGG + Intergenic
1083232615 11:61332829-61332851 CCGGGGCGGCGGGCCTCCCTAGG + Intronic
1084245585 11:67854820-67854842 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
1084536915 11:69762708-69762730 CCCTGGCTGCAGGCTGCCCTGGG - Intergenic
1084827103 11:71739758-71739780 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
1087105193 11:94401266-94401288 CCCGGCCCGCAGGCTCCCAGGGG - Exonic
1089334040 11:117710374-117710396 GCCAGCCGGCAGCCTTCCTTGGG + Intronic
1090382224 11:126335463-126335485 CCTGGCCTGGAGGCTTCCCGTGG + Intronic
1091763284 12:3101843-3101865 CAAGGCCGCCAGGCTTCGCTGGG - Intronic
1092416161 12:8291951-8291973 CCCGGACTGCAGGCATTCCTTGG + Intergenic
1094400694 12:30058277-30058299 CCCTGGCTGCAGGCATCCCTTGG - Intergenic
1095949721 12:47775295-47775317 CCCTCCCCACAGGCTTCCCTTGG + Intronic
1095999277 12:48115210-48115232 CCGGGTCAGCAGCCTTCCCTTGG - Intronic
1096784041 12:54007040-54007062 CCAGGGCTGCAGGCCTCCCTAGG - Intronic
1099188730 12:79542159-79542181 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
1099762600 12:86941099-86941121 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
1100847862 12:98678914-98678936 ACTGGCCTGCAGGCTCCCCTTGG + Intronic
1101278676 12:103227761-103227783 CTGGGAAGGCAGGCTTCCCTTGG - Intergenic
1104614052 12:130253956-130253978 CCCCGCCAGCAGGATTCACTGGG + Intergenic
1107779145 13:43879666-43879688 CCTGGCCGTCAGGTTTCCCCTGG + Exonic
1111126029 13:83911693-83911715 CCCGGGCTGCGGGCTTTCCTTGG + Intergenic
1111362362 13:87191344-87191366 CTGGGAAGGCAGGCTTCCCTTGG - Intergenic
1111999220 13:95194286-95194308 GCCGGCCTGCAGCCTCCCCTCGG + Intronic
1114221690 14:20702883-20702905 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
1118752906 14:68819530-68819552 CCCAGCCGGCTCCCTTCCCTGGG - Intergenic
1119793744 14:77377137-77377159 TCCGGCCTGCAGGCTGCGCTCGG - Exonic
1121108352 14:91295514-91295536 CCCAGCCGGCTTGGTTCCCTGGG - Intronic
1124218083 15:27825824-27825846 CCTGGCCGGCTGCCTTCCATGGG - Intronic
1124578413 15:30929291-30929313 CCAGGCCCGCAGGCTCTCCTCGG - Exonic
1128237613 15:66078656-66078678 CCCTGCCTGCAGGCTGCCCCTGG + Intronic
1128743190 15:70097071-70097093 AGCGGCCGGCCGCCTTCCCTGGG + Exonic
1129194404 15:73955554-73955576 CCTGCCCCGCAGCCTTCCCTTGG + Intergenic
1130531182 15:84748688-84748710 CCCGGCCCGCAGGCCCCGCTCGG - Intronic
1131133193 15:89912960-89912982 CCCGGCCCTCAGGCGTTCCTCGG + Intergenic
1131257424 15:90871667-90871689 CCGGCCCGGCCGGCTCCCCTCGG - Intronic
1131693658 15:94853991-94854013 CCCAGGCTGCAGGGTTCCCTAGG + Intergenic
1132535209 16:475658-475680 CCTGGCCGGCTGGATGCCCTGGG - Intronic
1132883795 16:2173609-2173631 CCCGGCAGGGAGGCCTCCCCTGG + Intronic
1134003887 16:10804450-10804472 CCCGGCCTGCTGGCTTCTTTTGG - Intronic
1136121442 16:28138075-28138097 CCCTGCCGGCATTCTTTCCTGGG - Intronic
1136737209 16:32475689-32475711 CCAGGCCGGCAGGCTCCCTGGGG - Intergenic
1137294440 16:47076806-47076828 ACCAGCGGGCAGGCTTCACTGGG + Intergenic
1138108390 16:54304165-54304187 CCATGCCCGCAGGCTTCCCTCGG - Intergenic
1139088730 16:63618321-63618343 GCAGGCCTGCAGGCGTCCCTTGG - Intergenic
1139597725 16:67968148-67968170 CCCGGCCGGCTGGCCTCCCTGGG + Intronic
1141714229 16:85717554-85717576 CCCGGCCAGCTGGCTCCCCGAGG - Intronic
1203015861 16_KI270728v1_random:353888-353910 CCAGGCCGGCAGGCTCCCTGGGG + Intergenic
1203034196 16_KI270728v1_random:627046-627068 CCAGGCCGGCAGGCTCCCTGGGG + Intergenic
1142591093 17:1006441-1006463 CAAGGGCGGGAGGCTTCCCTGGG - Intronic
1143619676 17:8073747-8073769 CCCGCCGGTCAGGCTTCCCTAGG - Exonic
1143814355 17:9499793-9499815 ACAGGCCAGCAGGCTTCCCAAGG + Intronic
1144776469 17:17787518-17787540 TCCTCCCGGCAGCCTTCCCTGGG + Intronic
1145190838 17:20841585-20841607 GCCGGGGGGCGGGCTTCCCTGGG + Intronic
1145263989 17:21370725-21370747 CCCGGCGGGGAGGCCTCCTTGGG + Intergenic
1149571395 17:57674984-57675006 CGCGGCCCGGAGGCTTCCCGGGG + Exonic
1149978023 17:61286206-61286228 CCCGCCCTGCAGGCTCCCCAAGG - Intronic
1151214544 17:72568709-72568731 CCCGGCCGGGAGGTTTTCTTAGG - Intergenic
1152390518 17:80001464-80001486 CCCGGCTGCCAGGCTGCGCTGGG + Intronic
1152499588 17:80698883-80698905 CCTGGCCAGCAGGCTCGCCTGGG - Intronic
1152572458 17:81126794-81126816 CCCGGGCAGCAGGAGTCCCTTGG + Intronic
1152615079 17:81334203-81334225 CCCTGCCCTCAGGCTTCCCTCGG + Intergenic
1152643409 17:81458306-81458328 CTCTGCCCGCAGGCTGCCCTTGG - Exonic
1152742702 17:82025301-82025323 CCTGGCCGGGGTGCTTCCCTAGG - Intronic
1158881002 18:61779651-61779673 CCCATCCTGCAGGCTCCCCTTGG + Intergenic
1160594090 18:79962398-79962420 CACGCCAGGCAGGCTTTCCTGGG + Intergenic
1160594115 18:79962512-79962534 GCCGCCCGGCAGGATTCCTTAGG + Intergenic
1160791267 19:924879-924901 CCCGCCCTCCAGGCTCCCCTGGG + Intergenic
1160995366 19:1879838-1879860 GCCGGGGGGCGGGCTTCCCTGGG - Intronic
1161129439 19:2579409-2579431 CCCGGTCGCCCGGCTTCCCGGGG - Intronic
1163209651 19:15831106-15831128 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
1165510574 19:36264441-36264463 CTGGGAAGGCAGGCTTCCCTTGG - Intergenic
1166465666 19:43028167-43028189 CCCGGCCTGGAGTCTTCCCAAGG - Intronic
1166763474 19:45238803-45238825 GCCGGCGGGCAGGCAGCCCTGGG - Intronic
1167208928 19:48121232-48121254 ACCGGCCGGCCCGCTTCCCCCGG + Exonic
1167360247 19:49026194-49026216 CCTGGCAGGCAGGCCTCCCCTGG - Intronic
1167360836 19:49029598-49029620 CCTGGCAGGCAGGCCTCCCCTGG + Intronic
1167362814 19:49039210-49039232 CCTGGCAGGCAGGCCTCCCCTGG - Intergenic
1167363322 19:49041978-49042000 CCTGGCAGGCAGGCCTCCCCTGG + Intergenic
1167365172 19:49050947-49050969 CCTGGCAGGCAGGCCTCCCCTGG - Intergenic
1168248154 19:55124842-55124864 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
1168436542 19:56322373-56322395 CTCAGCCGGCAGGCTTCCCTAGG + Intronic
925685944 2:6473697-6473719 TTCTGCAGGCAGGCTTCCCTTGG - Intergenic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
929793331 2:45039403-45039425 CTGGGAAGGCAGGCTTCCCTTGG - Intergenic
930487351 2:52025522-52025544 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
931292052 2:60881740-60881762 CCCCGCCGGCAGAGGTCCCTCGG + Exonic
931625501 2:64253223-64253245 CACGGAAGGCAGCCTTCCCTTGG + Intergenic
932452877 2:71827008-71827030 CCTGGGCGGCAGCCTTCCCCAGG - Intergenic
932779691 2:74552482-74552504 TCCGGCTGGCTGGCTTCCCCAGG - Exonic
933661017 2:84926976-84926998 CCAGGGCGGCAGGCTTTCCTCGG - Intergenic
934098157 2:88626859-88626881 CCCGGGCGGGCGTCTTCCCTCGG - Intronic
934308258 2:91843151-91843173 CCGGGCCGGCAGGCTCCCTGGGG + Intergenic
934946424 2:98545766-98545788 CCTGACCAGCAGGCTGCCCTTGG + Intronic
937126132 2:119476162-119476184 GCAGGAAGGCAGGCTTCCCTAGG - Intronic
937972380 2:127560595-127560617 CCCCGCCGCCAGGCTTCTCAAGG - Intronic
938296915 2:130184244-130184266 TCTGGCCGGCTGTCTTCCCTTGG - Intronic
938459845 2:131490412-131490434 CCCGGCTGGCTGTCTTCCCCTGG + Intronic
940265093 2:151828209-151828231 CCGGGCCGCCTGGCTTCCCCCGG + Exonic
940650379 2:156435729-156435751 CCCGGCCGGCAGGCTTCCCTAGG - Exonic
947819532 2:233060435-233060457 CCGGGCCGGCAGGCACCCCCAGG - Exonic
948499730 2:238383054-238383076 TCCAGCCTGCAGCCTTCCCTTGG + Intronic
948717836 2:239876764-239876786 CCCAGCCTGCAGGACTCCCTGGG + Intergenic
948729397 2:239953479-239953501 CCCGGCAGGCACCCCTCCCTGGG - Intronic
1169316180 20:4592691-4592713 CGCGGCTGCCAGGCTTCCCGCGG + Intergenic
1170458329 20:16554022-16554044 GCCGGCCTGCAGGCACCCCTTGG + Intronic
1172547323 20:35772092-35772114 CCCGGCCGGCCGGCTTCGCCTGG - Intronic
1172942507 20:38664117-38664139 CCCACCAGGCAGGGTTCCCTGGG + Intergenic
1172972109 20:38881218-38881240 CCAGGCAGCCGGGCTTCCCTGGG + Intronic
1173404503 20:42753089-42753111 CCAGGCAAGCAGGATTCCCTGGG - Intronic
1173738298 20:45377436-45377458 GCCGGCCTGCTGGCTCCCCTGGG + Intronic
1175283311 20:57819953-57819975 CCCCTCAGGCTGGCTTCCCTTGG + Intergenic
1176131575 20:63498800-63498822 CCCGGCCCGCAGGGTCCCCGCGG + Intronic
1177880637 21:26690103-26690125 CCCGCCCGGCAGCCTACTCTGGG - Intergenic
1179183154 21:39062197-39062219 CGTGGCCTGCAGGCTTCCCCAGG - Intergenic
1179469507 21:41601225-41601247 CCTGGCCCGCAGGTGTCCCTGGG + Intergenic
1179505351 21:41836255-41836277 CCCGGTGGGCATGCTTCTCTCGG - Intronic
1179616441 21:42586517-42586539 CCCGGCAGGCAGGCCACCGTCGG + Intergenic
1179923730 21:44521443-44521465 CCCGGCCCCCACGCTGCCCTGGG + Intronic
1180732428 22:17992186-17992208 CCTTGCCTGCAGGCTGCCCTTGG - Intronic
1180871664 22:19150173-19150195 CCGGGCCGGGAGGCTCCGCTCGG + Exonic
1181031335 22:20150029-20150051 CCCGGCTGGCACGCAGCCCTTGG - Exonic
1181121440 22:20670378-20670400 GCCGGGGGGCGGGCTTCCCTGGG - Intergenic
1181334399 22:22117402-22117424 GCCGGGGGGCGGGCTTCCCTGGG - Intergenic
1181486291 22:23233848-23233870 CCTGGCTGGCACGCCTCCCTGGG - Intronic
1181512000 22:23393373-23393395 CCCGGCTGGCACGCAGCCCTTGG + Intergenic
1181517176 22:23421501-23421523 CCTTGCCTGCAGGCTGCCCTTGG - Intergenic
1183708430 22:39488900-39488922 CCGGGCGGGCGGCCTTCCCTCGG - Exonic
1183746874 22:39697228-39697250 CCTGGCTGGGAGGTTTCCCTGGG + Intergenic
1183780517 22:39995821-39995843 CTCGGCCCCCAGTCTTCCCTGGG - Intronic
1184858206 22:47158002-47158024 TCCAGCCGGCAGGCGTGCCTGGG + Intronic
1185078361 22:48695478-48695500 CATGAACGGCAGGCTTCCCTTGG - Intronic
949953407 3:9248105-9248127 CCCTCCCGGCAGGCTTCTCCTGG + Intronic
950518170 3:13480549-13480571 CGCGGCCGGCGCGCGTCCCTCGG - Intronic
950525079 3:13518678-13518700 TCCCGCCTGCAGGCTTCCCCGGG - Intergenic
951034477 3:17918115-17918137 CCCGGACTGCAGGCTTCTCAAGG - Intronic
952663706 3:35879311-35879333 CTGGGAAGGCAGGCTTCCCTTGG - Intergenic
953802003 3:46031538-46031560 CCTGGCCTGCAGGCAACCCTTGG + Intergenic
954685615 3:52368654-52368676 CCCGGCGGCCAGGCTTCCCTGGG + Intronic
954706736 3:52484952-52484974 CCCTGTGAGCAGGCTTCCCTGGG + Intronic
958561909 3:95758777-95758799 CCCACCCTGCAGGCTTCGCTTGG + Intergenic
959543683 3:107570050-107570072 CCCGGGCTGCAGGCATTCCTTGG + Intronic
965262641 3:166504194-166504216 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
969749067 4:9096560-9096582 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
971834594 4:31747681-31747703 CTTGGCCAGCAGGCTGCCCTTGG + Intergenic
982232645 4:153223062-153223084 CCCGGGCGGGAGGGTTCCCAGGG - Intronic
983380180 4:166981785-166981807 GCAGGCCAGCAGGCTCCCCTTGG - Intronic
985671565 5:1209450-1209472 CCAGGCCTGCAGGCTTCCGAAGG - Intronic
985988281 5:3535596-3535618 CCCCGGCCGCAGCCTTCCCTCGG - Intergenic
986426251 5:7634919-7634941 CCAGGCAGGGAGGCTTCTCTGGG + Intronic
987193317 5:15500585-15500607 CCCGTCGGGCGGGCTTTCCTCGG + Exonic
992390383 5:76325824-76325846 CTAGGCAGCCAGGCTTCCCTGGG + Exonic
992528067 5:77630510-77630532 ACCGGCCGCCAGGCTGCACTGGG + Exonic
993192723 5:84700777-84700799 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
994245438 5:97471311-97471333 ACTGGCCTGCAGGCATCCCTTGG - Intergenic
996052664 5:118950620-118950642 CCCGGGCTGCAGGCATTCCTTGG + Intronic
996917692 5:128731844-128731866 CCTGGGCTGCAGGCATCCCTTGG - Intronic
997240323 5:132301832-132301854 TCAGGCCTGCAGGCTGCCCTGGG + Intronic
1000407132 5:160899972-160899994 CTGGGCTGGAAGGCTTCCCTTGG - Intergenic
1003154469 6:3579312-3579334 CCTGGCCAGCATCCTTCCCTTGG - Intergenic
1006428691 6:33982224-33982246 CTCCCCAGGCAGGCTTCCCTTGG - Intergenic
1006430869 6:33995003-33995025 CAAGGCAGGCAGGCTGCCCTGGG + Intergenic
1010827166 6:80487353-80487375 CTGGGAAGGCAGGCTTCCCTTGG - Intergenic
1014360149 6:120465679-120465701 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
1014455160 6:121625508-121625530 CTGGGAAGGCAGGCTTCCCTTGG - Intergenic
1015965519 6:138692869-138692891 AGGGGCCGCCAGGCTTCCCTCGG - Intergenic
1016114131 6:140260823-140260845 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
1016204547 6:141455127-141455149 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
1016518818 6:144925469-144925491 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
1016650621 6:146455682-146455704 CTGGGAAGGCAGGCTTCCCTTGG - Intergenic
1017779610 6:157705731-157705753 CTGGGAAGGCAGGCTTCCCTTGG - Intronic
1017981420 6:159403809-159403831 GCCGACCGGCTCGCTTCCCTTGG + Intergenic
1019153866 6:170026044-170026066 CCTGGCCCCCAGGCTTGCCTGGG + Intergenic
1019656386 7:2198300-2198322 GCCGGCCTGGAGGCTTCCATGGG - Intronic
1020358792 7:7305012-7305034 CCTGGCAGTCAGGCTTTCCTTGG + Intergenic
1020532703 7:9356832-9356854 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
1023221250 7:37921398-37921420 CCCCGCCAGCAGGCCGCCCTCGG - Intronic
1027138049 7:75638745-75638767 CCCGTCCGGCAGGTCTCCCGAGG + Intronic
1027851958 7:83461962-83461984 CCCGGCCTGCGGGCATTCCTTGG - Intronic
1033306888 7:140231466-140231488 CACGGCCCGCGGGCTTCCATTGG - Intergenic
1033520860 7:142158967-142158989 CCCTGCTGGGAGGCTTTCCTGGG + Intronic
1034448612 7:151125935-151125957 CCCGGCCGGCCGGCTGCGCACGG - Intronic
1035233776 7:157483749-157483771 CCGGGCCGGGAGCCTCCCCTTGG - Intergenic
1035281144 7:157779241-157779263 CCTGGCTGCCAGGCTTCCCTGGG + Intronic
1036372141 8:8170904-8170926 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
1036878760 8:12494737-12494759 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
1040850704 8:51898663-51898685 CCCGACCTCCAGGCTTCGCTGGG + Intronic
1043533064 8:81171771-81171793 GCAGGCCGGCAGGCACCCCTTGG - Intergenic
1049004935 8:139848781-139848803 CCCCGTAGGCAGCCTTCCCTTGG + Intronic
1049349852 8:142158748-142158770 CTCGGCCGGCCGCCTTCCCCTGG + Intergenic
1049686923 8:143942746-143942768 CCGGGCTGGGAGGCTGCCCTGGG + Intronic
1056882760 9:90413478-90413500 CTGGGAAGGCAGGCTTCCCTTGG + Intergenic
1059494515 9:114698583-114698605 CCCTCCCGGCAGGCTTCCTATGG + Intergenic
1062331261 9:136045923-136045945 CCCGGCCGGCTGCCTTGCCGGGG + Intronic
1062478736 9:136741958-136741980 CCTGGCCGGCAAGAATCCCTGGG + Exonic
1187086511 X:16048099-16048121 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
1190251667 X:48731603-48731625 CTAGACCAGCAGGCTTCCCTGGG - Intergenic
1192201481 X:69069158-69069180 CCCGGAAGCCTGGCTTCCCTGGG - Intergenic
1194822756 X:98527682-98527704 CCCGGGCTGCAGGCATTCCTTGG + Intergenic
1195126469 X:101813722-101813744 GCTGGCCTGCAGGCTCCCCTTGG + Intergenic
1197499733 X:127228899-127228921 CCCGGGCTGCAGGCATTCCTTGG - Intergenic
1198205418 X:134460442-134460464 CCCCGCCTGCGGGGTTCCCTGGG - Intronic
1200111467 X:153743081-153743103 CCGGGCCGGCAGGCTCCCTGGGG + Intronic