ID: 940654189

View in Genome Browser
Species Human (GRCh38)
Location 2:156468579-156468601
Sequence AACCCCAAGATGTAACCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940654189_940654192 26 Left 940654189 2:156468579-156468601 CCTCTAGGTTACATCTTGGGGTT No data
Right 940654192 2:156468628-156468650 ACATCTGGATTTCTCAGTGTAGG No data
940654189_940654190 11 Left 940654189 2:156468579-156468601 CCTCTAGGTTACATCTTGGGGTT No data
Right 940654190 2:156468613-156468635 TTTGAAATGCCTTGTACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940654189 Original CRISPR AACCCCAAGATGTAACCTAG AGG (reversed) Intronic