ID: 940654190

View in Genome Browser
Species Human (GRCh38)
Location 2:156468613-156468635
Sequence TTTGAAATGCCTTGTACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940654189_940654190 11 Left 940654189 2:156468579-156468601 CCTCTAGGTTACATCTTGGGGTT No data
Right 940654190 2:156468613-156468635 TTTGAAATGCCTTGTACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940654190 Original CRISPR TTTGAAATGCCTTGTACATC TGG Intronic
No off target data available for this crispr