ID: 940656150

View in Genome Browser
Species Human (GRCh38)
Location 2:156489896-156489918
Sequence AGAAGGAAGGAGGGTAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656150_940656167 29 Left 940656150 2:156489896-156489918 CCTTCACTACCCTCCTTCCTTCT No data
Right 940656167 2:156489948-156489970 TACCCCCTCTCCCTGACGCAGGG No data
940656150_940656166 28 Left 940656150 2:156489896-156489918 CCTTCACTACCCTCCTTCCTTCT No data
Right 940656166 2:156489947-156489969 CTACCCCCTCTCCCTGACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656150 Original CRISPR AGAAGGAAGGAGGGTAGTGA AGG (reversed) Intronic