ID: 940656151

View in Genome Browser
Species Human (GRCh38)
Location 2:156489905-156489927
Sequence GGAGGGGAGAGAAGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656151_940656166 19 Left 940656151 2:156489905-156489927 CCCTCCTTCCTTCTCTCCCCTCC No data
Right 940656166 2:156489947-156489969 CTACCCCCTCTCCCTGACGCAGG No data
940656151_940656167 20 Left 940656151 2:156489905-156489927 CCCTCCTTCCTTCTCTCCCCTCC No data
Right 940656167 2:156489948-156489970 TACCCCCTCTCCCTGACGCAGGG No data
940656151_940656172 26 Left 940656151 2:156489905-156489927 CCCTCCTTCCTTCTCTCCCCTCC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656151 Original CRISPR GGAGGGGAGAGAAGGAAGGA GGG (reversed) Intronic