ID: 940656155

View in Genome Browser
Species Human (GRCh38)
Location 2:156489921-156489943
Sequence GAGGGAAGAAAGGAGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656155_940656172 10 Left 940656155 2:156489921-156489943 CCCCTCCCCTCCTTTCTTCCCTC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656155_940656175 28 Left 940656155 2:156489921-156489943 CCCCTCCCCTCCTTTCTTCCCTC No data
Right 940656175 2:156489972-156489994 TTCGGTCTCCCAGTTAATATAGG No data
940656155_940656176 29 Left 940656155 2:156489921-156489943 CCCCTCCCCTCCTTTCTTCCCTC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656155_940656167 4 Left 940656155 2:156489921-156489943 CCCCTCCCCTCCTTTCTTCCCTC No data
Right 940656167 2:156489948-156489970 TACCCCCTCTCCCTGACGCAGGG No data
940656155_940656166 3 Left 940656155 2:156489921-156489943 CCCCTCCCCTCCTTTCTTCCCTC No data
Right 940656166 2:156489947-156489969 CTACCCCCTCTCCCTGACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656155 Original CRISPR GAGGGAAGAAAGGAGGGGAG GGG (reversed) Intronic