ID: 940656156

View in Genome Browser
Species Human (GRCh38)
Location 2:156489922-156489944
Sequence GGAGGGAAGAAAGGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656156_940656166 2 Left 940656156 2:156489922-156489944 CCCTCCCCTCCTTTCTTCCCTCC No data
Right 940656166 2:156489947-156489969 CTACCCCCTCTCCCTGACGCAGG No data
940656156_940656175 27 Left 940656156 2:156489922-156489944 CCCTCCCCTCCTTTCTTCCCTCC No data
Right 940656175 2:156489972-156489994 TTCGGTCTCCCAGTTAATATAGG No data
940656156_940656172 9 Left 940656156 2:156489922-156489944 CCCTCCCCTCCTTTCTTCCCTCC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656156_940656176 28 Left 940656156 2:156489922-156489944 CCCTCCCCTCCTTTCTTCCCTCC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656156_940656167 3 Left 940656156 2:156489922-156489944 CCCTCCCCTCCTTTCTTCCCTCC No data
Right 940656167 2:156489948-156489970 TACCCCCTCTCCCTGACGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656156 Original CRISPR GGAGGGAAGAAAGGAGGGGA GGG (reversed) Intronic
No off target data available for this crispr