ID: 940656159 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:156489927-156489949 |
Sequence | TAGTGGGAGGGAAGAAAGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 6 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
940656159_940656178 | 30 | Left | 940656159 | 2:156489927-156489949 | CCCTCCTTTCTTCCCTCCCACTA | No data | ||
Right | 940656178 | 2:156489980-156490002 | CCCAGTTAATATAGGGCCTATGG | No data | ||||
940656159_940656167 | -2 | Left | 940656159 | 2:156489927-156489949 | CCCTCCTTTCTTCCCTCCCACTA | No data | ||
Right | 940656167 | 2:156489948-156489970 | TACCCCCTCTCCCTGACGCAGGG | No data | ||||
940656159_940656166 | -3 | Left | 940656159 | 2:156489927-156489949 | CCCTCCTTTCTTCCCTCCCACTA | No data | ||
Right | 940656166 | 2:156489947-156489969 | CTACCCCCTCTCCCTGACGCAGG | No data | ||||
940656159_940656172 | 4 | Left | 940656159 | 2:156489927-156489949 | CCCTCCTTTCTTCCCTCCCACTA | No data | ||
Right | 940656172 | 2:156489954-156489976 | CTCTCCCTGACGCAGGGTTTCGG | No data | ||||
940656159_940656176 | 23 | Left | 940656159 | 2:156489927-156489949 | CCCTCCTTTCTTCCCTCCCACTA | No data | ||
Right | 940656176 | 2:156489973-156489995 | TCGGTCTCCCAGTTAATATAGGG | No data | ||||
940656159_940656175 | 22 | Left | 940656159 | 2:156489927-156489949 | CCCTCCTTTCTTCCCTCCCACTA | No data | ||
Right | 940656175 | 2:156489972-156489994 | TTCGGTCTCCCAGTTAATATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
940656159 | Original CRISPR | TAGTGGGAGGGAAGAAAGGA GGG (reversed) | Intronic | ||