ID: 940656159

View in Genome Browser
Species Human (GRCh38)
Location 2:156489927-156489949
Sequence TAGTGGGAGGGAAGAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656159_940656167 -2 Left 940656159 2:156489927-156489949 CCCTCCTTTCTTCCCTCCCACTA No data
Right 940656167 2:156489948-156489970 TACCCCCTCTCCCTGACGCAGGG No data
940656159_940656178 30 Left 940656159 2:156489927-156489949 CCCTCCTTTCTTCCCTCCCACTA No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656159_940656176 23 Left 940656159 2:156489927-156489949 CCCTCCTTTCTTCCCTCCCACTA No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656159_940656172 4 Left 940656159 2:156489927-156489949 CCCTCCTTTCTTCCCTCCCACTA No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656159_940656166 -3 Left 940656159 2:156489927-156489949 CCCTCCTTTCTTCCCTCCCACTA No data
Right 940656166 2:156489947-156489969 CTACCCCCTCTCCCTGACGCAGG No data
940656159_940656175 22 Left 940656159 2:156489927-156489949 CCCTCCTTTCTTCCCTCCCACTA No data
Right 940656175 2:156489972-156489994 TTCGGTCTCCCAGTTAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656159 Original CRISPR TAGTGGGAGGGAAGAAAGGA GGG (reversed) Intronic
No off target data available for this crispr