ID: 940656162

View in Genome Browser
Species Human (GRCh38)
Location 2:156489939-156489961
Sequence AGGGAGAGGGGGTAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656162_940656176 11 Left 940656162 2:156489939-156489961 CCCTCCCACTACCCCCTCTCCCT No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656162_940656180 29 Left 940656162 2:156489939-156489961 CCCTCCCACTACCCCCTCTCCCT No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656162_940656175 10 Left 940656162 2:156489939-156489961 CCCTCCCACTACCCCCTCTCCCT No data
Right 940656175 2:156489972-156489994 TTCGGTCTCCCAGTTAATATAGG No data
940656162_940656178 18 Left 940656162 2:156489939-156489961 CCCTCCCACTACCCCCTCTCCCT No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656162_940656172 -8 Left 940656162 2:156489939-156489961 CCCTCCCACTACCCCCTCTCCCT No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656162 Original CRISPR AGGGAGAGGGGGTAGTGGGA GGG (reversed) Intronic