ID: 940656162 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:156489939-156489961 |
Sequence | AGGGAGAGGGGGTAGTGGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
940656162_940656175 | 10 | Left | 940656162 | 2:156489939-156489961 | CCCTCCCACTACCCCCTCTCCCT | No data | ||
Right | 940656175 | 2:156489972-156489994 | TTCGGTCTCCCAGTTAATATAGG | No data | ||||
940656162_940656180 | 29 | Left | 940656162 | 2:156489939-156489961 | CCCTCCCACTACCCCCTCTCCCT | No data | ||
Right | 940656180 | 2:156489991-156490013 | TAGGGCCTATGGCCATTCCAAGG | No data | ||||
940656162_940656178 | 18 | Left | 940656162 | 2:156489939-156489961 | CCCTCCCACTACCCCCTCTCCCT | No data | ||
Right | 940656178 | 2:156489980-156490002 | CCCAGTTAATATAGGGCCTATGG | No data | ||||
940656162_940656176 | 11 | Left | 940656162 | 2:156489939-156489961 | CCCTCCCACTACCCCCTCTCCCT | No data | ||
Right | 940656176 | 2:156489973-156489995 | TCGGTCTCCCAGTTAATATAGGG | No data | ||||
940656162_940656172 | -8 | Left | 940656162 | 2:156489939-156489961 | CCCTCCCACTACCCCCTCTCCCT | No data | ||
Right | 940656172 | 2:156489954-156489976 | CTCTCCCTGACGCAGGGTTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
940656162 | Original CRISPR | AGGGAGAGGGGGTAGTGGGA GGG (reversed) | Intronic | ||