ID: 940656163

View in Genome Browser
Species Human (GRCh38)
Location 2:156489940-156489962
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656163_940656178 17 Left 940656163 2:156489940-156489962 CCTCCCACTACCCCCTCTCCCTG No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656163_940656180 28 Left 940656163 2:156489940-156489962 CCTCCCACTACCCCCTCTCCCTG No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656163_940656175 9 Left 940656163 2:156489940-156489962 CCTCCCACTACCCCCTCTCCCTG No data
Right 940656175 2:156489972-156489994 TTCGGTCTCCCAGTTAATATAGG No data
940656163_940656172 -9 Left 940656163 2:156489940-156489962 CCTCCCACTACCCCCTCTCCCTG No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656163_940656176 10 Left 940656163 2:156489940-156489962 CCTCCCACTACCCCCTCTCCCTG No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656163 Original CRISPR CAGGGAGAGGGGGTAGTGGG AGG (reversed) Intronic