ID: 940656168

View in Genome Browser
Species Human (GRCh38)
Location 2:156489950-156489972
Sequence AACCCTGCGTCAGGGAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656168_940656175 -1 Left 940656168 2:156489950-156489972 CCCCCTCTCCCTGACGCAGGGTT No data
Right 940656175 2:156489972-156489994 TTCGGTCTCCCAGTTAATATAGG No data
940656168_940656178 7 Left 940656168 2:156489950-156489972 CCCCCTCTCCCTGACGCAGGGTT No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656168_940656176 0 Left 940656168 2:156489950-156489972 CCCCCTCTCCCTGACGCAGGGTT No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656168_940656180 18 Left 940656168 2:156489950-156489972 CCCCCTCTCCCTGACGCAGGGTT No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656168 Original CRISPR AACCCTGCGTCAGGGAGAGG GGG (reversed) Intronic