ID: 940656171

View in Genome Browser
Species Human (GRCh38)
Location 2:156489953-156489975
Sequence CGAAACCCTGCGTCAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656171_940656175 -4 Left 940656171 2:156489953-156489975 CCTCTCCCTGACGCAGGGTTTCG No data
Right 940656175 2:156489972-156489994 TTCGGTCTCCCAGTTAATATAGG No data
940656171_940656176 -3 Left 940656171 2:156489953-156489975 CCTCTCCCTGACGCAGGGTTTCG No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656171_940656180 15 Left 940656171 2:156489953-156489975 CCTCTCCCTGACGCAGGGTTTCG No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656171_940656178 4 Left 940656171 2:156489953-156489975 CCTCTCCCTGACGCAGGGTTTCG No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656171 Original CRISPR CGAAACCCTGCGTCAGGGAG AGG (reversed) Intronic