ID: 940656172

View in Genome Browser
Species Human (GRCh38)
Location 2:156489954-156489976
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656156_940656172 9 Left 940656156 2:156489922-156489944 CCCTCCCCTCCTTTCTTCCCTCC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656160_940656172 3 Left 940656160 2:156489928-156489950 CCTCCTTTCTTCCCTCCCACTAC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656158_940656172 5 Left 940656158 2:156489926-156489948 CCCCTCCTTTCTTCCCTCCCACT No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656154_940656172 18 Left 940656154 2:156489913-156489935 CCTTCTCTCCCCTCCCCTCCTTT No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656157_940656172 8 Left 940656157 2:156489923-156489945 CCTCCCCTCCTTTCTTCCCTCCC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656163_940656172 -9 Left 940656163 2:156489940-156489962 CCTCCCACTACCCCCTCTCCCTG No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656151_940656172 26 Left 940656151 2:156489905-156489927 CCCTCCTTCCTTCTCTCCCCTCC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656161_940656172 0 Left 940656161 2:156489931-156489953 CCTTTCTTCCCTCCCACTACCCC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656159_940656172 4 Left 940656159 2:156489927-156489949 CCCTCCTTTCTTCCCTCCCACTA No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656152_940656172 25 Left 940656152 2:156489906-156489928 CCTCCTTCCTTCTCTCCCCTCCC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656155_940656172 10 Left 940656155 2:156489921-156489943 CCCCTCCCCTCCTTTCTTCCCTC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656162_940656172 -8 Left 940656162 2:156489939-156489961 CCCTCCCACTACCCCCTCTCCCT No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data
940656153_940656172 22 Left 940656153 2:156489909-156489931 CCTTCCTTCTCTCCCCTCCCCTC No data
Right 940656172 2:156489954-156489976 CTCTCCCTGACGCAGGGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type