ID: 940656173 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:156489958-156489980 |
| Sequence | GAGACCGAAACCCTGCGTCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940656173_940656175 | -9 | Left | 940656173 | 2:156489958-156489980 | CCCTGACGCAGGGTTTCGGTCTC | No data | ||
| Right | 940656175 | 2:156489972-156489994 | TTCGGTCTCCCAGTTAATATAGG | No data | ||||
| 940656173_940656180 | 10 | Left | 940656173 | 2:156489958-156489980 | CCCTGACGCAGGGTTTCGGTCTC | No data | ||
| Right | 940656180 | 2:156489991-156490013 | TAGGGCCTATGGCCATTCCAAGG | No data | ||||
| 940656173_940656176 | -8 | Left | 940656173 | 2:156489958-156489980 | CCCTGACGCAGGGTTTCGGTCTC | No data | ||
| Right | 940656176 | 2:156489973-156489995 | TCGGTCTCCCAGTTAATATAGGG | No data | ||||
| 940656173_940656178 | -1 | Left | 940656173 | 2:156489958-156489980 | CCCTGACGCAGGGTTTCGGTCTC | No data | ||
| Right | 940656178 | 2:156489980-156490002 | CCCAGTTAATATAGGGCCTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940656173 | Original CRISPR | GAGACCGAAACCCTGCGTCA GGG (reversed) | Intronic | ||