ID: 940656174

View in Genome Browser
Species Human (GRCh38)
Location 2:156489959-156489981
Sequence GGAGACCGAAACCCTGCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656174_940656176 -9 Left 940656174 2:156489959-156489981 CCTGACGCAGGGTTTCGGTCTCC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656174_940656178 -2 Left 940656174 2:156489959-156489981 CCTGACGCAGGGTTTCGGTCTCC No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656174_940656180 9 Left 940656174 2:156489959-156489981 CCTGACGCAGGGTTTCGGTCTCC No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656174_940656175 -10 Left 940656174 2:156489959-156489981 CCTGACGCAGGGTTTCGGTCTCC No data
Right 940656175 2:156489972-156489994 TTCGGTCTCCCAGTTAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656174 Original CRISPR GGAGACCGAAACCCTGCGTC AGG (reversed) Intronic
No off target data available for this crispr