ID: 940656176

View in Genome Browser
Species Human (GRCh38)
Location 2:156489973-156489995
Sequence TCGGTCTCCCAGTTAATATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656169_940656176 -1 Left 940656169 2:156489951-156489973 CCCCTCTCCCTGACGCAGGGTTT No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656173_940656176 -8 Left 940656173 2:156489958-156489980 CCCTGACGCAGGGTTTCGGTCTC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656158_940656176 24 Left 940656158 2:156489926-156489948 CCCCTCCTTTCTTCCCTCCCACT No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656161_940656176 19 Left 940656161 2:156489931-156489953 CCTTTCTTCCCTCCCACTACCCC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656171_940656176 -3 Left 940656171 2:156489953-156489975 CCTCTCCCTGACGCAGGGTTTCG No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656160_940656176 22 Left 940656160 2:156489928-156489950 CCTCCTTTCTTCCCTCCCACTAC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656164_940656176 7 Left 940656164 2:156489943-156489965 CCCACTACCCCCTCTCCCTGACG No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656174_940656176 -9 Left 940656174 2:156489959-156489981 CCTGACGCAGGGTTTCGGTCTCC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656170_940656176 -2 Left 940656170 2:156489952-156489974 CCCTCTCCCTGACGCAGGGTTTC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656157_940656176 27 Left 940656157 2:156489923-156489945 CCTCCCCTCCTTTCTTCCCTCCC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656163_940656176 10 Left 940656163 2:156489940-156489962 CCTCCCACTACCCCCTCTCCCTG No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656168_940656176 0 Left 940656168 2:156489950-156489972 CCCCCTCTCCCTGACGCAGGGTT No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656155_940656176 29 Left 940656155 2:156489921-156489943 CCCCTCCCCTCCTTTCTTCCCTC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656156_940656176 28 Left 940656156 2:156489922-156489944 CCCTCCCCTCCTTTCTTCCCTCC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656162_940656176 11 Left 940656162 2:156489939-156489961 CCCTCCCACTACCCCCTCTCCCT No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656165_940656176 6 Left 940656165 2:156489944-156489966 CCACTACCCCCTCTCCCTGACGC No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data
940656159_940656176 23 Left 940656159 2:156489927-156489949 CCCTCCTTTCTTCCCTCCCACTA No data
Right 940656176 2:156489973-156489995 TCGGTCTCCCAGTTAATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656176 Original CRISPR TCGGTCTCCCAGTTAATATA GGG Intronic
No off target data available for this crispr