ID: 940656178

View in Genome Browser
Species Human (GRCh38)
Location 2:156489980-156490002
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656170_940656178 5 Left 940656170 2:156489952-156489974 CCCTCTCCCTGACGCAGGGTTTC No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656171_940656178 4 Left 940656171 2:156489953-156489975 CCTCTCCCTGACGCAGGGTTTCG No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656163_940656178 17 Left 940656163 2:156489940-156489962 CCTCCCACTACCCCCTCTCCCTG No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656159_940656178 30 Left 940656159 2:156489927-156489949 CCCTCCTTTCTTCCCTCCCACTA No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656162_940656178 18 Left 940656162 2:156489939-156489961 CCCTCCCACTACCCCCTCTCCCT No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656165_940656178 13 Left 940656165 2:156489944-156489966 CCACTACCCCCTCTCCCTGACGC No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656174_940656178 -2 Left 940656174 2:156489959-156489981 CCTGACGCAGGGTTTCGGTCTCC No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656161_940656178 26 Left 940656161 2:156489931-156489953 CCTTTCTTCCCTCCCACTACCCC No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656160_940656178 29 Left 940656160 2:156489928-156489950 CCTCCTTTCTTCCCTCCCACTAC No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656173_940656178 -1 Left 940656173 2:156489958-156489980 CCCTGACGCAGGGTTTCGGTCTC No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656168_940656178 7 Left 940656168 2:156489950-156489972 CCCCCTCTCCCTGACGCAGGGTT No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656164_940656178 14 Left 940656164 2:156489943-156489965 CCCACTACCCCCTCTCCCTGACG No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data
940656169_940656178 6 Left 940656169 2:156489951-156489973 CCCCTCTCCCTGACGCAGGGTTT No data
Right 940656178 2:156489980-156490002 CCCAGTTAATATAGGGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type