ID: 940656180

View in Genome Browser
Species Human (GRCh38)
Location 2:156489991-156490013
Sequence TAGGGCCTATGGCCATTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656173_940656180 10 Left 940656173 2:156489958-156489980 CCCTGACGCAGGGTTTCGGTCTC No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656162_940656180 29 Left 940656162 2:156489939-156489961 CCCTCCCACTACCCCCTCTCCCT No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656163_940656180 28 Left 940656163 2:156489940-156489962 CCTCCCACTACCCCCTCTCCCTG No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656174_940656180 9 Left 940656174 2:156489959-156489981 CCTGACGCAGGGTTTCGGTCTCC No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656169_940656180 17 Left 940656169 2:156489951-156489973 CCCCTCTCCCTGACGCAGGGTTT No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656168_940656180 18 Left 940656168 2:156489950-156489972 CCCCCTCTCCCTGACGCAGGGTT No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656164_940656180 25 Left 940656164 2:156489943-156489965 CCCACTACCCCCTCTCCCTGACG No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656171_940656180 15 Left 940656171 2:156489953-156489975 CCTCTCCCTGACGCAGGGTTTCG No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656170_940656180 16 Left 940656170 2:156489952-156489974 CCCTCTCCCTGACGCAGGGTTTC No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data
940656165_940656180 24 Left 940656165 2:156489944-156489966 CCACTACCCCCTCTCCCTGACGC No data
Right 940656180 2:156489991-156490013 TAGGGCCTATGGCCATTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656180 Original CRISPR TAGGGCCTATGGCCATTCCA AGG Intronic
No off target data available for this crispr