ID: 940656608

View in Genome Browser
Species Human (GRCh38)
Location 2:156494712-156494734
Sequence TGGGAAAAACACCACCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940656600_940656608 18 Left 940656600 2:156494671-156494693 CCTGTTGGCCTAGAGCTTCAAAT No data
Right 940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG No data
940656604_940656608 10 Left 940656604 2:156494679-156494701 CCTAGAGCTTCAAATGGGGCTCC No data
Right 940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940656608 Original CRISPR TGGGAAAAACACCACCATCA TGG Intronic
No off target data available for this crispr