ID: 940657128

View in Genome Browser
Species Human (GRCh38)
Location 2:156501373-156501395
Sequence TTATGGAATTAGAATGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940657125_940657128 13 Left 940657125 2:156501337-156501359 CCTAAGGCAGTATAGCGCAGTGA No data
Right 940657128 2:156501373-156501395 TTATGGAATTAGAATGAACTTGG No data
940657123_940657128 25 Left 940657123 2:156501325-156501347 CCCACTATAATTCCTAAGGCAGT No data
Right 940657128 2:156501373-156501395 TTATGGAATTAGAATGAACTTGG No data
940657124_940657128 24 Left 940657124 2:156501326-156501348 CCACTATAATTCCTAAGGCAGTA No data
Right 940657128 2:156501373-156501395 TTATGGAATTAGAATGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940657128 Original CRISPR TTATGGAATTAGAATGAACT TGG Intronic
No off target data available for this crispr