ID: 940665021

View in Genome Browser
Species Human (GRCh38)
Location 2:156598600-156598622
Sequence CATTTCCTACAGAGTTCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940665019_940665021 10 Left 940665019 2:156598567-156598589 CCAGAACACTTAAGAATCATCTG No data
Right 940665021 2:156598600-156598622 CATTTCCTACAGAGTTCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940665021 Original CRISPR CATTTCCTACAGAGTTCTAT GGG Intronic
No off target data available for this crispr