ID: 940665873

View in Genome Browser
Species Human (GRCh38)
Location 2:156608906-156608928
Sequence GAAAATTGGTGGGCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940665867_940665873 6 Left 940665867 2:156608877-156608899 CCCATGAGGAACAGATAATCAAA No data
Right 940665873 2:156608906-156608928 GAAAATTGGTGGGCTGCTACTGG No data
940665866_940665873 13 Left 940665866 2:156608870-156608892 CCTTTCACCCATGAGGAACAGAT No data
Right 940665873 2:156608906-156608928 GAAAATTGGTGGGCTGCTACTGG No data
940665863_940665873 27 Left 940665863 2:156608856-156608878 CCCAGCAAATCATGCCTTTCACC No data
Right 940665873 2:156608906-156608928 GAAAATTGGTGGGCTGCTACTGG No data
940665868_940665873 5 Left 940665868 2:156608878-156608900 CCATGAGGAACAGATAATCAAAC No data
Right 940665873 2:156608906-156608928 GAAAATTGGTGGGCTGCTACTGG No data
940665864_940665873 26 Left 940665864 2:156608857-156608879 CCAGCAAATCATGCCTTTCACCC No data
Right 940665873 2:156608906-156608928 GAAAATTGGTGGGCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940665873 Original CRISPR GAAAATTGGTGGGCTGCTAC TGG Intronic
No off target data available for this crispr