ID: 940670157

View in Genome Browser
Species Human (GRCh38)
Location 2:156657699-156657721
Sequence CTGTACAGGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940670151_940670157 22 Left 940670151 2:156657654-156657676 CCATTACATAAGAAAATTTTCAA No data
Right 940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940670157 Original CRISPR CTGTACAGGGAGAAGGAGAA GGG Intergenic
No off target data available for this crispr