ID: 940672071

View in Genome Browser
Species Human (GRCh38)
Location 2:156682816-156682838
Sequence CTGTCACTTTGTAAGATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940672071_940672074 24 Left 940672071 2:156682816-156682838 CCATAGATCTTACAAAGTGACAG No data
Right 940672074 2:156682863-156682885 ATCAATGAATGAAAAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940672071 Original CRISPR CTGTCACTTTGTAAGATCTA TGG (reversed) Intergenic
No off target data available for this crispr