ID: 940677811

View in Genome Browser
Species Human (GRCh38)
Location 2:156746560-156746582
Sequence TTCTGGGTGTGGAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940677811_940677834 29 Left 940677811 2:156746560-156746582 CCATTTTCCCTCCACACCCAGAA No data
Right 940677834 2:156746612-156746634 CCAGGGTCAGTGCAGGTTGGGGG No data
940677811_940677821 11 Left 940677811 2:156746560-156746582 CCATTTTCCCTCCACACCCAGAA No data
Right 940677821 2:156746594-156746616 AGTCACCCCATGCCCTGCCCAGG No data
940677811_940677832 28 Left 940677811 2:156746560-156746582 CCATTTTCCCTCCACACCCAGAA No data
Right 940677832 2:156746611-156746633 CCCAGGGTCAGTGCAGGTTGGGG No data
940677811_940677830 27 Left 940677811 2:156746560-156746582 CCATTTTCCCTCCACACCCAGAA No data
Right 940677830 2:156746610-156746632 GCCCAGGGTCAGTGCAGGTTGGG No data
940677811_940677826 22 Left 940677811 2:156746560-156746582 CCATTTTCCCTCCACACCCAGAA No data
Right 940677826 2:156746605-156746627 GCCCTGCCCAGGGTCAGTGCAGG No data
940677811_940677829 26 Left 940677811 2:156746560-156746582 CCATTTTCCCTCCACACCCAGAA No data
Right 940677829 2:156746609-156746631 TGCCCAGGGTCAGTGCAGGTTGG No data
940677811_940677822 12 Left 940677811 2:156746560-156746582 CCATTTTCCCTCCACACCCAGAA No data
Right 940677822 2:156746595-156746617 GTCACCCCATGCCCTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940677811 Original CRISPR TTCTGGGTGTGGAGGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr