ID: 940683897

View in Genome Browser
Species Human (GRCh38)
Location 2:156821981-156822003
Sequence TGGACTTTTACCCATCGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940683897_940683901 6 Left 940683897 2:156821981-156822003 CCAACACGATGGGTAAAAGTCCA No data
Right 940683901 2:156822010-156822032 CCATAATCCCCTCAACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940683897 Original CRISPR TGGACTTTTACCCATCGTGT TGG (reversed) Intergenic
No off target data available for this crispr