ID: 940686981

View in Genome Browser
Species Human (GRCh38)
Location 2:156864123-156864145
Sequence AAAAGATGGTAAGGTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940686981_940686985 13 Left 940686981 2:156864123-156864145 CCACATGGACCTTACCATCTTTT No data
Right 940686985 2:156864159-156864181 CAAGAGGAGACCACAAGATGAGG No data
940686981_940686987 29 Left 940686981 2:156864123-156864145 CCACATGGACCTTACCATCTTTT No data
Right 940686987 2:156864175-156864197 GATGAGGAATACTTCACTGCAGG No data
940686981_940686984 -3 Left 940686981 2:156864123-156864145 CCACATGGACCTTACCATCTTTT No data
Right 940686984 2:156864143-156864165 TTTTTCTTTAAATTATCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940686981 Original CRISPR AAAAGATGGTAAGGTCCATG TGG (reversed) Intergenic