ID: 940686982

View in Genome Browser
Species Human (GRCh38)
Location 2:156864132-156864154
Sequence TTTAAAGAAAAAAGATGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940686982_940686988 23 Left 940686982 2:156864132-156864154 CCTTACCATCTTTTTTCTTTAAA No data
Right 940686988 2:156864178-156864200 GAGGAATACTTCACTGCAGGTGG No data
940686982_940686985 4 Left 940686982 2:156864132-156864154 CCTTACCATCTTTTTTCTTTAAA No data
Right 940686985 2:156864159-156864181 CAAGAGGAGACCACAAGATGAGG No data
940686982_940686987 20 Left 940686982 2:156864132-156864154 CCTTACCATCTTTTTTCTTTAAA No data
Right 940686987 2:156864175-156864197 GATGAGGAATACTTCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940686982 Original CRISPR TTTAAAGAAAAAAGATGGTA AGG (reversed) Intergenic