ID: 940686983

View in Genome Browser
Species Human (GRCh38)
Location 2:156864137-156864159
Sequence GATAATTTAAAGAAAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940686983_940686987 15 Left 940686983 2:156864137-156864159 CCATCTTTTTTCTTTAAATTATC No data
Right 940686987 2:156864175-156864197 GATGAGGAATACTTCACTGCAGG No data
940686983_940686988 18 Left 940686983 2:156864137-156864159 CCATCTTTTTTCTTTAAATTATC No data
Right 940686988 2:156864178-156864200 GAGGAATACTTCACTGCAGGTGG No data
940686983_940686985 -1 Left 940686983 2:156864137-156864159 CCATCTTTTTTCTTTAAATTATC No data
Right 940686985 2:156864159-156864181 CAAGAGGAGACCACAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940686983 Original CRISPR GATAATTTAAAGAAAAAAGA TGG (reversed) Intergenic