ID: 940686987

View in Genome Browser
Species Human (GRCh38)
Location 2:156864175-156864197
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940686983_940686987 15 Left 940686983 2:156864137-156864159 CCATCTTTTTTCTTTAAATTATC No data
Right 940686987 2:156864175-156864197 GATGAGGAATACTTCACTGCAGG No data
940686981_940686987 29 Left 940686981 2:156864123-156864145 CCACATGGACCTTACCATCTTTT No data
Right 940686987 2:156864175-156864197 GATGAGGAATACTTCACTGCAGG No data
940686982_940686987 20 Left 940686982 2:156864132-156864154 CCTTACCATCTTTTTTCTTTAAA No data
Right 940686987 2:156864175-156864197 GATGAGGAATACTTCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type