ID: 940686988 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:156864178-156864200 |
Sequence | GAGGAATACTTCACTGCAGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
940686982_940686988 | 23 | Left | 940686982 | 2:156864132-156864154 | CCTTACCATCTTTTTTCTTTAAA | No data | ||
Right | 940686988 | 2:156864178-156864200 | GAGGAATACTTCACTGCAGGTGG | No data | ||||
940686983_940686988 | 18 | Left | 940686983 | 2:156864137-156864159 | CCATCTTTTTTCTTTAAATTATC | No data | ||
Right | 940686988 | 2:156864178-156864200 | GAGGAATACTTCACTGCAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
940686988 | Original CRISPR | GAGGAATACTTCACTGCAGG TGG | Intergenic | ||