ID: 940686988

View in Genome Browser
Species Human (GRCh38)
Location 2:156864178-156864200
Sequence GAGGAATACTTCACTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940686982_940686988 23 Left 940686982 2:156864132-156864154 CCTTACCATCTTTTTTCTTTAAA No data
Right 940686988 2:156864178-156864200 GAGGAATACTTCACTGCAGGTGG No data
940686983_940686988 18 Left 940686983 2:156864137-156864159 CCATCTTTTTTCTTTAAATTATC No data
Right 940686988 2:156864178-156864200 GAGGAATACTTCACTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940686988 Original CRISPR GAGGAATACTTCACTGCAGG TGG Intergenic