ID: 940688537

View in Genome Browser
Species Human (GRCh38)
Location 2:156884866-156884888
Sequence GAATTAGATGCCACTCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940688537_940688541 1 Left 940688537 2:156884866-156884888 CCCATAGGAGTGGCATCTAATTC No data
Right 940688541 2:156884890-156884912 GCTGTGACAGGGTTTAAGAGAGG No data
940688537_940688542 26 Left 940688537 2:156884866-156884888 CCCATAGGAGTGGCATCTAATTC No data
Right 940688542 2:156884915-156884937 AGTTAAAGATGATTTGAGTGAGG No data
940688537_940688540 -10 Left 940688537 2:156884866-156884888 CCCATAGGAGTGGCATCTAATTC No data
Right 940688540 2:156884879-156884901 CATCTAATTCAGCTGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940688537 Original CRISPR GAATTAGATGCCACTCCTAT GGG (reversed) Intergenic
No off target data available for this crispr