ID: 940694330

View in Genome Browser
Species Human (GRCh38)
Location 2:156959684-156959706
Sequence TGGACACTGAGGAGCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940694330_940694341 10 Left 940694330 2:156959684-156959706 CCTCCTGTGCTCCTCAGTGTCCA No data
Right 940694341 2:156959717-156959739 GGGCCAAAGCAGCAGGGGGCTGG No data
940694330_940694340 6 Left 940694330 2:156959684-156959706 CCTCCTGTGCTCCTCAGTGTCCA No data
Right 940694340 2:156959713-156959735 GAAGGGGCCAAAGCAGCAGGGGG No data
940694330_940694335 -10 Left 940694330 2:156959684-156959706 CCTCCTGTGCTCCTCAGTGTCCA No data
Right 940694335 2:156959697-156959719 TCAGTGTCCAAAGTGTGAAGGGG No data
940694330_940694339 5 Left 940694330 2:156959684-156959706 CCTCCTGTGCTCCTCAGTGTCCA No data
Right 940694339 2:156959712-156959734 TGAAGGGGCCAAAGCAGCAGGGG No data
940694330_940694337 3 Left 940694330 2:156959684-156959706 CCTCCTGTGCTCCTCAGTGTCCA No data
Right 940694337 2:156959710-156959732 TGTGAAGGGGCCAAAGCAGCAGG No data
940694330_940694338 4 Left 940694330 2:156959684-156959706 CCTCCTGTGCTCCTCAGTGTCCA No data
Right 940694338 2:156959711-156959733 GTGAAGGGGCCAAAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940694330 Original CRISPR TGGACACTGAGGAGCACAGG AGG (reversed) Intergenic
No off target data available for this crispr