ID: 940695989

View in Genome Browser
Species Human (GRCh38)
Location 2:156979263-156979285
Sequence GTCTGACTTGGGACGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940695989_940695994 19 Left 940695989 2:156979263-156979285 CCTGTCAGCGTCCCAAGTCAGAC No data
Right 940695994 2:156979305-156979327 TGGACATCCCTCAAAAGACCTGG No data
940695989_940695993 -1 Left 940695989 2:156979263-156979285 CCTGTCAGCGTCCCAAGTCAGAC No data
Right 940695993 2:156979285-156979307 CAAAACAGGTATCAGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940695989 Original CRISPR GTCTGACTTGGGACGCTGAC AGG (reversed) Intergenic
No off target data available for this crispr