ID: 940698523

View in Genome Browser
Species Human (GRCh38)
Location 2:157011878-157011900
Sequence CAATTGGAACTGGTGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940698517_940698523 26 Left 940698517 2:157011829-157011851 CCTAGTGTCTAATGTCTCGTATC No data
Right 940698523 2:157011878-157011900 CAATTGGAACTGGTGGCCACTGG No data
940698519_940698523 -9 Left 940698519 2:157011864-157011886 CCCTAGAAATGACACAATTGGAA No data
Right 940698523 2:157011878-157011900 CAATTGGAACTGGTGGCCACTGG No data
940698520_940698523 -10 Left 940698520 2:157011865-157011887 CCTAGAAATGACACAATTGGAAC No data
Right 940698523 2:157011878-157011900 CAATTGGAACTGGTGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940698523 Original CRISPR CAATTGGAACTGGTGGCCAC TGG Intergenic
No off target data available for this crispr