ID: 940699036

View in Genome Browser
Species Human (GRCh38)
Location 2:157018977-157018999
Sequence GAATGACAGCAAACTCTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940699036_940699037 0 Left 940699036 2:157018977-157018999 CCAATAAGAGTTTGCTGTCATTC No data
Right 940699037 2:157019000-157019022 TTACCTTTGTGTCTGTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940699036 Original CRISPR GAATGACAGCAAACTCTTAT TGG (reversed) Intergenic