ID: 940699037

View in Genome Browser
Species Human (GRCh38)
Location 2:157019000-157019022
Sequence TTACCTTTGTGTCTGTTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940699035_940699037 24 Left 940699035 2:157018953-157018975 CCACAGTCTTTGCTTACATTGTT No data
Right 940699037 2:157019000-157019022 TTACCTTTGTGTCTGTTATGTGG No data
940699036_940699037 0 Left 940699036 2:157018977-157018999 CCAATAAGAGTTTGCTGTCATTC No data
Right 940699037 2:157019000-157019022 TTACCTTTGTGTCTGTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940699037 Original CRISPR TTACCTTTGTGTCTGTTATG TGG Intergenic
No off target data available for this crispr